12 results for search term 'aav'  in category Model System

CD4/CD8 Human Primary T cell

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System grnaLabId : AAVS1_site_14 AAVS1_site_13 AAVS1_site_12 AAVS1_site_11 AAVS1_site_10 guideTargetLocus : AAVS1
CD4/CD8 Human Primary T cell

Human kidney organoid (iPSC-derived)

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV
Kidney organoid derived from human male BJFF iPS cells

Ai9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice Evolving High Potency AAV Vectors for Neuromuscular Genome Editing deliverySystemName : AAV AAV+Focused Ultrasound vectorName : AAVrh8-ZsGreen-Cre AAVcc47-CMV-SaCas9 AAV9-CMV-SaCas9 AAV6-ZsGreen-Cre AAV4-ZsGreen-Cre vectorSubtype : AAV capsidSerotype : AAV BI28 (novel engineered variant)
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.
Show Experiments (11)

Ai9 mouse immortalized fibroblasts

Model System  - [In Vitro] [Mouse]
Matched Fields: category : Model System vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice

Human kidney organoid (stem cell-derived)

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2-SaCas9 AAV2/8CMVeGFP AAV2-gRNA vectorSubtype : AAV
Kidney organoid derived from human female H9 ES or BJFF iPS cells

C57BL/6 mouse (Asokan study)

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAV9-mCherry AAVcc47-mCherry AAVcc84-GFP AAVcc81-GFP AAV9-GFP vectorSubtype : AAV

Human kidney organoid (ESC-derived)

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV
Kidney organoid derived from human female H9 embryonic stem cells

TLR-2 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System deliverySystemName : AAV+Focused Ultrasound
R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways.

HEK-293T with Ai9 transient reporter assay

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System vectorName : PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)
HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.

Ai9 mouse (BCM)

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System vectorName : AAVcc47-Cre AAVcc47-SaCas9-Ai9 vectorSubtype : AAV
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.

Ai9-SauSpyCas9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System vectorSubtype : AAV
Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.

12 results for search term 'aav'  in category Model System

Type Organism Subtype Name Description Source View Associated...
Cell Human Primary cells CD4/CD8 Human Primary T cell CD4/CD8 Human Primary T cell Key Biologicals
Organoid Human Human kidney organoid (iPSC-derived) Kidney organoid derived from human male BJFF iPS cells Morizane lab
Animal Mouse Ai9 mouse Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The Jackson Laboratory
Show Experiments (11)
Cell Mouse Immortalized Fibroblast (unspecified) Ai9 mouse immortalized fibroblasts Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice
Organoid Human Human kidney organoid (stem cell-derived) Kidney organoid derived from human female H9 ES or BJFF iPS cells Morizane lab
Animal Mouse C57BL/6 mouse (Asokan study) Unspecified
Organoid Human Human kidney organoid (ESC-derived) Kidney organoid derived from human female H9 embryonic stem cells Morizane lab
Animal Mouse TLR-2 mouse R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways. The Jackson Laboratory
Cell Human Immortalized HEK-293T with Ai9 transient reporter assay HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.
Animal Mouse Ai9 mouse (BCM) Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Baylor College of Medicine
Animal Mouse C57BL/6J mouse C57BL/6J WT mouse The Jackson Laboratory
Animal Mouse Ai9-SauSpyCas9 mouse Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Baylor College of Medicine